Insertion junction: LMJ.RY0402.230639_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.230639
Chromosome:chromosome_7
Location:1372072
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre07.g322550 FAP240 Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):ATGAGCGACAGGTGCGGACATAAAAGGGGG
Internal bar code:GCGTCTTAACTTTTACAGGCCG

Confirmation - LEAP-Seq

LEAP-Seq distance:740
LEAP-Seq percent confirming:97.7871
LEAP-Seq n confirming:37252
LEAP-Seq n nonconfirming:843
LEAP-Seq n unique pos:384

Suggested primers for confirmation by PCR

Suggested primer 1:AAAGGAGGTCAGCACTCGAA
Suggested primer 2:ACCACATTGCCCTTCTTGTC