| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.230639 |
| Chromosome: | chromosome 7 |
| Location: | 1372074 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g322550 | FAP240 | Flagellar Associated Protein 240; (1 of 1) PF14977 - FAM194 protein (FAM194) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAAGGTGACCACAAACCCAGCTGCTTGT |
| Internal bar code: | GTGGGGCTCACTGCTGTGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1387 |
| LEAP-Seq percent confirming: | 98.3192 |
| LEAP-Seq n confirming: | 25212 |
| LEAP-Seq n nonconfirming: | 431 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGGAGGTCAGCACTCGAA |
| Suggested primer 2: | ACCACATTGCCCTTCTTGTC |