| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.230663 |
| Chromosome: | chromosome 9 |
| Location: | 528354 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404000 | CPLD59 | (1 of 1) PF00805 - Pentapeptide repeats (8 copies) (Pentapeptide); thylakoid lumenal 17.4 kDa protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCTACCGTATCCAGCATCGGACGCTGC |
| Internal bar code: | TTGGGTTACCCGGGTCGTTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 771 |
| LEAP-Seq percent confirming: | 98.8861 |
| LEAP-Seq n confirming: | 7191 |
| LEAP-Seq n nonconfirming: | 81 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTTGAGCCTTTCATTCCT |
| Suggested primer 2: | GCGTAGCAAGAAGGGACAAG |