Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.230669 |
Chromosome: | chromosome 2 |
Location: | 1598069 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g085050 | COP1,PCOP1 | Plant-type constitutive photomorphogenesis protein 1; (1 of 2) K10143 - E3 ubiquitin-protein ligase RFWD2 (RFWD2, COP1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGAATAGCTAGAGTCAGACGTGCTTGG |
Internal bar code: | TTATGCTACGGCCGGCGTGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 986 |
LEAP-Seq percent confirming: | 92.9412 |
LEAP-Seq n confirming: | 79 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAAGACCACCAAAGACACCG |
Suggested primer 2: | TGTTCGTGTACTACCGCTCG |