| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.230742 |
| Chromosome: | chromosome 16 |
| Location: | 1841294 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g655450 | (1 of 1) PF14510 - ABC-transporter extracellular N-terminal (ABC_trans_N) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAACCGGTAATCCTTCCCATGCACAGAAC |
| Internal bar code: | GAACGGGCGTAGTGACAGGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 604 |
| LEAP-Seq percent confirming: | 99.0385 |
| LEAP-Seq n confirming: | 515 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAACTTGGCTTGGTCATGG |
| Suggested primer 2: | CGGGCCACAAAACTTACCTA |