Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.230756 |
Chromosome: | chromosome 3 |
Location: | 2528854 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g160050 | FAP184 | (1 of 1) PTHR15654:SF1 - COILED-COIL DOMAIN-CONTAINING PROTEIN 96; Flagellar Associated Protein 184 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGGACAAACCCCAGCCAGCCTGCGTCG |
Internal bar code: | GTACGGTGGACGGCGCGCCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 146 |
LEAP-Seq percent confirming: | 93.8596 |
LEAP-Seq n confirming: | 107 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGGCGCGTTTATTGTATG |
Suggested primer 2: | CACCTCATTGACTTCGAGCA |