Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.230798 |
Chromosome: | chromosome 16 |
Location: | 5955051 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676850 | (1 of 14) IPR003593//IPR003959//IPR027417 - AAA+ ATPase domain // ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTATGCGACGAGATGTCCTGTCTGCTG |
Internal bar code: | TCTACTCGCGGGTGGCAAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 585 |
LEAP-Seq percent confirming: | 99.0881 |
LEAP-Seq n confirming: | 1630 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGTGCGTCCTTACGTTTCC |
Suggested primer 2: | AAACAGGACCTGACCGTGAC |