Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.230856 |
Chromosome: | chromosome 8 |
Location: | 3809775 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g377400 | (1 of 110) 3.4.19.12 - Ubiquitinyl hydrolase 1 / Ubiquitin thiolesterase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGAGCATGGGCAAGGCCACGATGCGGGC |
Internal bar code: | ACTACTCATCGTCTCGATTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 127 |
LEAP-Seq percent confirming: | 47.6852 |
LEAP-Seq n confirming: | 103 |
LEAP-Seq n nonconfirming: | 113 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTTGACTCGTTGGAGAGC |
Suggested primer 2: | GCCGCATTCTACTCTTCGAC |