Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.230904 |
Chromosome: | chromosome 12 |
Location: | 3683607 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g514450 | SPL20 | Pre-mRNA splicing factor; (1 of 1) K12829 - splicing factor 3B subunit 2 (SF3B2, SAP145, CUS1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAAGTTGGTGCGTGGCCACTCGAATTTG |
Internal bar code: | TATGGGTCCATACTCAGGGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 735 |
LEAP-Seq percent confirming: | 56.1364 |
LEAP-Seq n confirming: | 494 |
LEAP-Seq n nonconfirming: | 386 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATCGCTATCCCCTCCACAG |
Suggested primer 2: | AAATCGTCACATTTCTCCGC |