| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.230908 |
| Chromosome: | chromosome 8 |
| Location: | 697919 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g360300 | SDR11 | Short-chain dehydrogenase/reductase; (1 of 1) 1.1.1.300//1.1.1.330 - NADP-retinol dehydrogenase / Retinol dehydrogenase (NADP(+)) // Very-long-chain 3-oxoacyl-CoA reductase / Very-long-chain beta-ketoacyl-CoA reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAAGTTCCCGACACGCCCAACCCCGCCCC |
| Internal bar code: | AACTGGGAGGCGCGTATACCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 591 |
| LEAP-Seq percent confirming: | 94.0299 |
| LEAP-Seq n confirming: | 189 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGACAGAGAAGCCTTTGGG |
| Suggested primer 2: | GGCTTGTGAGGTACCGTGTT |