| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.230935 |
| Chromosome: | chromosome 12 |
| Location: | 5691310 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532600 | CGL44 | RabGAP/TBC Domain Protein; (1 of 14) PF00566 - Rab-GTPase-TBC domain (RabGAP-TBC) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCTTGTCGGCCACGTGCGCCAGGAACT |
| Internal bar code: | AGGTCGATTATGGTCCTAAACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 734 |
| LEAP-Seq percent confirming: | 99.6316 |
| LEAP-Seq n confirming: | 7302 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTCTAGCTGTCGTGGAAC |
| Suggested primer 2: | CATCGCTATCCTCTTGCTCC |