| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.230943 |
| Chromosome: | chromosome 16 |
| Location: | 1977191 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g656500 | ALA3 | (1 of 1) K01530 - phospholipid-translocating ATPase (E3.6.3.1); ATPase, phospholipid transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTAATACGGTACATGCACACTTGAGCGCC |
| Internal bar code: | CATAGCGCCCTGTCTTCCGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 859 |
| LEAP-Seq percent confirming: | 97.561 |
| LEAP-Seq n confirming: | 120 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTCCTGCAAGCTGTTCAC |
| Suggested primer 2: | GGTCGGGCTTATACAGGTGA |