| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.230995 |
| Chromosome: | chromosome 13 |
| Location: | 2783783 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g582800 | (1 of 1) 6.3.2.11 - Carnosine synthase / Carnosine synthetase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCACCACCATGAGCTCGCACAGCCACGTG |
| Internal bar code: | CCCATCCCGGAACTGGTGGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 597 |
| LEAP-Seq percent confirming: | 78.5023 |
| LEAP-Seq n confirming: | 2757 |
| LEAP-Seq n nonconfirming: | 755 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGGACAACACCACTCCT |
| Suggested primer 2: | GGATGTTTGGAAAAGCGGTA |