| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.231055 |
| Chromosome: | chromosome 10 |
| Location: | 2193079 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433800 | CSE21 | Predicted protein of CSE family | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACAGGTCTTTCAGTCTACCCCAATGTTC |
| Internal bar code: | CGACAGCGAACATACTTTGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 420 |
| LEAP-Seq percent confirming: | 21.5496 |
| LEAP-Seq n confirming: | 89 |
| LEAP-Seq n nonconfirming: | 324 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATATCCACCTGCAACATCG |
| Suggested primer 2: | CCATGATTAAGAGCGTGGGT |