| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.231166 |
| Chromosome: | chromosome 4 |
| Location: | 658572 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217949 | AXL6 | (1 of 1) 2.4.1.37 - Fucosylgalactoside 3-alpha-galactosyltransferase / galactosyltransferase; Arabinose chain extension enzyme like protein 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCTCTGTACCAATCCTTGAAACCCCCT |
| Internal bar code: | GCCTGTGGGCGGTACCTCGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 354 |
| LEAP-Seq percent confirming: | 96.6667 |
| LEAP-Seq n confirming: | 58 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | COULD_NOT_FIND_PRIMER |
| Suggested primer 2: | GGTCGGTCTAACACGCTCAT |