| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.231201 |
| Chromosome: | chromosome 2 |
| Location: | 3483848 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095122 | FKB16H,FKB16-8,FKB11 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 25) PTHR10516 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCTACTATCACACCAATACGCACTGAG |
| Internal bar code: | TCCGCGGCTATCACAGGGAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 595 |
| LEAP-Seq percent confirming: | 97.8585 |
| LEAP-Seq n confirming: | 1051 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGCAACCAACATCCCAAT |
| Suggested primer 2: | CTTGTCTCGGAGCTACAGGG |