Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.231221 |
Chromosome: | chromosome 10 |
Location: | 1997714 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g432500 | CND1 | Condensin complex component; (1 of 1) K06677 - condensin complex subunit 1 (YCS4, CNAP1, CAPD2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGATGGCCAACAGCAGCTTGATTCGGCTG |
Internal bar code: | TTTGGTCGTTCGTATTAGCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 578 |
LEAP-Seq percent confirming: | 98.6928 |
LEAP-Seq n confirming: | 1057 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACCCCCTCCAGATCCATAC |
Suggested primer 2: | GGGAGCAGTTGGAGATACCA |