Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.231221 |
Chromosome: | chromosome 16 |
Location: | 5013718 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g684800 | (1 of 1) PF00240//PF13855 - Ubiquitin family (ubiquitin) // Leucine rich repeat (LRR_8) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGAGGTGCATTGCCTTGGGGTCTGTAGG |
Internal bar code: | GGACACCCATGCGGAGTCCCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 579 |
LEAP-Seq percent confirming: | 99.5384 |
LEAP-Seq n confirming: | 4960 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTCAAGTGCCCTATTGCTG |
Suggested primer 2: | GCCCTTGACCACCTGTGTAT |