| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.231249 |
| Chromosome: | chromosome 6 |
| Location: | 5065576 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280500 | PPP23 | (1 of 1) PTHR23081//PTHR23081:SF1 - RNA POLYMERASE II CTD PHOSPHATASE // RNA POLYMERASE II C-TERMINAL DOMAIN PHOSPHATASE-LIKE 2; Phosphoprotein phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACGCCTCCTGGTCGCTGGGCAGCTCGCC |
| Internal bar code: | AGCTTGCCCCCGCGAAACCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 341 |
| LEAP-Seq percent confirming: | 80.8378 |
| LEAP-Seq n confirming: | 907 |
| LEAP-Seq n nonconfirming: | 215 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGTGGTTGACTATTGCTT |
| Suggested primer 2: | GTGTGGTTTCCGACTCCTGT |