Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.231402 |
Chromosome: | chromosome 6 |
Location: | 1253362 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g257950 | AST4 | (1 of 1) K14455 - aspartate aminotransferase, mitochondrial (GOT2); aspartate aminotransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGCAATACCTCCTGACTCCTGGCTTACA |
Internal bar code: | CTCGTATGCCGCATAACTCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 710 |
LEAP-Seq percent confirming: | 97.5008 |
LEAP-Seq n confirming: | 6359 |
LEAP-Seq n nonconfirming: | 163 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATGAATGTGTTGCATGCGT |
Suggested primer 2: | TGTGCAATGCCTTGACTCTC |