| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.231411 |
| Chromosome: | chromosome 10 |
| Location: | 1474781 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g428692 | (1 of 1) IPR000945//IPR002110//IPR020683 - Dopamine beta-hydroxylase-related // Ankyrin repeat // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCAAATGCCCAGCCCGCGCCGCCGCGC |
| Internal bar code: | TAAGGACCGGGGAGGCGCTGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 627 |
| LEAP-Seq percent confirming: | 43.7643 |
| LEAP-Seq n confirming: | 572 |
| LEAP-Seq n nonconfirming: | 735 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGCAGTTGGATGTCCTC |
| Suggested primer 2: | TAACAAAAGCCTTCAACGGG |