| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.231417 |
| Chromosome: | chromosome 7 |
| Location: | 6172379 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g356150 | (1 of 1) 3.4.24.84 - Ste24 endopeptidase / Prenyl protein-specific endoprotease 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCCAGCCTGACAACGCGCTCCCCGGAC |
| Internal bar code: | CCTGCGGAGGGGACCTAGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 172 |
| LEAP-Seq percent confirming: | 97.7658 |
| LEAP-Seq n confirming: | 4726 |
| LEAP-Seq n nonconfirming: | 108 |
| LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAAGCTCTTTCACACTGC |
| Suggested primer 2: | ATCACCACACGCTTACCTCC |