Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.231446 |
Chromosome: | chromosome 3 |
Location: | 392827 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g144887 | (1 of 1) IPR000048//IPR003590//IPR006553 - IQ motif, EF-hand binding site // Leucine-rich repeat, ribonuclease inhibitor subtype // Leucine-rich repeat, cysteine-containing subtype | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGCTGGTATTTACAATCCCCTTTATCC |
Internal bar code: | GGGAGACAGTGGAGCAGAATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 619 |
LEAP-Seq percent confirming: | 98.5258 |
LEAP-Seq n confirming: | 802 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATGTCCCTGCACAATCCT |
Suggested primer 2: | CACGCAACTCCCATGTATTG |