Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.231453 |
Chromosome: | chromosome 12 |
Location: | 216913 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g484900 | FAP83 | (1 of 2) PF13879 - KIAA1430 homologue (KIAA1430); Flagellar Associated Protein 83 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCAAGCGGCCTTGACTCTGAGCCGCATA |
Internal bar code: | CTGGAGGGCGTGCGGGGGGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 581 |
LEAP-Seq percent confirming: | 99.5099 |
LEAP-Seq n confirming: | 3452 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCTCAACGATGAACGAGA |
Suggested primer 2: | ATTGCCTCCAGACCTACCCT |