| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.231521 |
| Chromosome: | chromosome 4 |
| Location: | 2617597 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g222750 | CCP2 | Low-CO2-inducible membrane protein; (1 of 5) K15109 - solute carrier family 25 (mitochondrial carnitine/acylcarnitine transporter), member 20/29 (SLC25A20_29, CACT, CACL, CRC1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTTTCGAGGGACACTTGAAGATGAGCA |
| Internal bar code: | CGCAGGGGGTCTTCGAAGGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 522 |
| LEAP-Seq percent confirming: | 99.3333 |
| LEAP-Seq n confirming: | 149 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACGAGGAGAACGTGGAGC |
| Suggested primer 2: | GTAGCAGAGCCAGTCAAGGG |