| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.231596 |
| Chromosome: | chromosome 6 |
| Location: | 8380915 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g306800 | CGL126 | protein tyrosine kinase; (1 of 1) K08851 - TP53 regulating kinase and related kinases [EC:2.7.11.1] (TP53RK, PRPK, BUD32) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGTCGCCACATCGCCACAGCATAAAGAT |
| Internal bar code: | GTACGTCAGTTCTTGACGGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 324 |
| LEAP-Seq percent confirming: | 99.7286 |
| LEAP-Seq n confirming: | 5144 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGCATTTGTTGGAGAGGG |
| Suggested primer 2: | CATACACCTCAACCGTCGTG |