| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.231646 |
| Chromosome: | chromosome 1 |
| Location: | 47763 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000200 | (1 of 33) IPR013830 - SGNH hydrolase-type esterase domain; Esterase, SGNH hydrolase-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACGGTGGGTGTTGGGGGTGGGGTGTTA |
| Internal bar code: | CTCTCCGGCCAGGAGAGTGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 395 |
| LEAP-Seq percent confirming: | 99.0909 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCAAACATCGAAGCAAGG |
| Suggested primer 2: | TCAGCATGCCTACAAGAACG |