| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.231680 |
| Chromosome: | chromosome 3 |
| Location: | 2820680 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g162333 | (1 of 3) IPR000104//IPR003439//IPR003593//IPR013525//IPR027417 - Antifreeze protein, type I // ABC transporter-like // AAA+ ATPase domain // ABC-2 type transporter // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTGAGAGGAGTGGGGAGGAGTGGGGAG |
| Internal bar code: | AGGAGCGTGGTTCGGTGGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 252 |
| LEAP-Seq percent confirming: | 85.3041 |
| LEAP-Seq n confirming: | 505 |
| LEAP-Seq n nonconfirming: | 87 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATGTTTGGAAAAGCGGTA |
| Suggested primer 2: | CGATTATGTGTGTGGCCTTG |