Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.231744 |
Chromosome: | chromosome_12 |
Location: | 740136 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre12.g495250 | FAL15 | Similar to Flagellar Associated Protein FAP31 | antisense | 3'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | GGCGAGCGTGTGTGAGGGAGGCTTCGGGAG |
Internal bar code: | CGTTACTATATACGTGCGTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 147 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGGTCAGGTTGTGGAGTT |
Suggested primer 2: | CTCGGAGCTTGAAGGTTACG |