Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.231800 |
Chromosome: | chromosome 5 |
Location: | 1318010 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g244800 | NUOAF3 | (1 of 1) PTHR13194//PTHR13194:SF19 - COMPLEX I INTERMEDIATE-ASSOCIATED PROTEIN 30 // NAD(P)-BINDING ROSSMANN-FOLD SUPERFAMILY PROTEIN; Protein with predicted nucleoside-diphosphate-sugar epimerase activity | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATCCATCCGGCTCATCATGGCCGGCGCA |
Internal bar code: | CCGCGGCGGGTTGAACGTTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 319 |
LEAP-Seq percent confirming: | 99.5652 |
LEAP-Seq n confirming: | 9618 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCTAGGGCTTGACAAACG |
Suggested primer 2: | AGATCATGGGTTAGGCAACG |