| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.231963 |
| Chromosome: | chromosome 7 |
| Location: | 2068052 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325950 | ZSP1 | (1 of 2) PTHR10783:SF44 - SPX DOMAIN-CONTAINING PROTEIN 1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCAGGCGAGCGAGATGGAGGAGGAAGC |
| Internal bar code: | GGAACGGCATGGAGCTGCCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 578 |
| LEAP-Seq percent confirming: | 96.9504 |
| LEAP-Seq n confirming: | 763 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCACTGCCATAATGTCCAA |
| Suggested primer 2: | ACCATCGCCAGTACAACTCC |