| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.232042 |
| Chromosome: | chromosome 17 |
| Location: | 3131570 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g721500 | GBSS1A,STA2,GBBSI,GBS1 | (1 of 2) 2.4.1.242 - NDP-glucose--starch glucosyltransferase / Waxy protein; Granule-bound starch synthase IA | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGCCGATGCCGCCGGCGGTGTGGAGCT |
| Internal bar code: | GGCACATCGACAACTTAGCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 334 |
| LEAP-Seq percent confirming: | 99.0741 |
| LEAP-Seq n confirming: | 3424 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAAGTTCACGACCACCAC |
| Suggested primer 2: | TGCGTGTCTCTGAACCTCAC |