| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.232059 |
| Chromosome: | chromosome 3 |
| Location: | 2786423 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g162050 | HDA4 | RPD3/HDA1 type histone deacetylase; (1 of 1) PTHR10625//PTHR10625:SF120 - HISTONE DEACETYLASE // HISTONE DEACETYLASE 15 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCGTGGGGGGTTGCGGCACAGGGTTGCA |
| Internal bar code: | CTCGGTGTCTTATAGAGCGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 500 |
| LEAP-Seq percent confirming: | 20.4717 |
| LEAP-Seq n confirming: | 2092 |
| LEAP-Seq n nonconfirming: | 8127 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAGGGAATGCCAAAAGTC |
| Suggested primer 2: | AACCATTGGGGTGACTGGTA |