Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.232092 |
Chromosome: | chromosome 1 |
Location: | 4715429 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g032500 | DNJ8,TPR2 | Tetratricopeptide-repeat protein 2; (1 of 1) K09523 - DnaJ homolog subfamily C member 3 (DNAJC3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGAAGGTGAAGTGCATGCCGCCCTGCTGG |
Internal bar code: | TTGCACATTCGCAACCGAGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 662 |
LEAP-Seq percent confirming: | 88.7331 |
LEAP-Seq n confirming: | 7592 |
LEAP-Seq n nonconfirming: | 964 |
LEAP-Seq n unique pos: | 104 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCACCAAGAGAACGTGAG |
Suggested primer 2: | GTGCCTTCTGTCCCAACAAT |