Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.232096 |
Chromosome: | chromosome 7 |
Location: | 3832247 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g338550 | (1 of 1) IPR002048//IPR006585//IPR006652//IPR008979//IPR011043//IPR011050 - EF-hand domain // Fucolectin tachylectin-4 pentraxin-1 // Kelch repeat type 1 // Galactose-binding domain-like // Galactose oxidase/kelch, beta-propeller // Pectin lyase fold/virulence factor | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGGCCGGCCGCGGGGCGCGTGGCGGAC |
Internal bar code: | GGTTCGACTGTCACCTAGAGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 153 |
LEAP-Seq percent confirming: | 96.5379 |
LEAP-Seq n confirming: | 725 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGACGTAGCTCCTGTTGCC |
Suggested primer 2: | GAGCTGTACGAAGTCCAGGG |