Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.232155 |
Chromosome: | chromosome 16 |
Location: | 881453 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g648150 | (1 of 6) PTHR24114//PTHR24114:SF2 - FAMILY NOT NAMED // LEUCINE-RICH REPEAT-CONTAINING PROTEIN 74 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCAGCAGAAGCACCGCCGCATACGACC |
Internal bar code: | GCGGGGTCGCACGGCGCTGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 39 |
LEAP-Seq percent confirming: | 77.0833 |
LEAP-Seq n confirming: | 37 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGTGCTGGTGGGATTACT |
Suggested primer 2: | GTAGGGAAGTGCGGTTACCA |