| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.232176 |
| Chromosome: | chromosome 9 |
| Location: | 5147130 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398993 | HPD1 | (1 of 3) 1.13.11.27 - 4-hydroxyphenylpyruvate dioxygenase / p-hydroxyphenylpyruvate oxidase; 4-hydroxyphenylpyruvate dioxygenase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCAGGCCATAAGAGAACCTGTGGGTTA |
| Internal bar code: | GGGGGAAAACGCAAGAGCGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 588 |
| LEAP-Seq percent confirming: | 99.0141 |
| LEAP-Seq n confirming: | 1406 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGACCTCCGAGATGACCTG |
| Suggested primer 2: | CGCCAAGCTCTGATACAACA |