| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.232255 |
| Chromosome: | chromosome 12 |
| Location: | 6964269 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g560250 | (1 of 5) PF04884 - Vitamin B6 photo-protection and homoeostasis (DUF647) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGTAGACCATCTTGGGAGCAGCAATTG |
| Internal bar code: | GTAACATTGAGTGTTCGAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 501 |
| LEAP-Seq percent confirming: | 90.995 |
| LEAP-Seq n confirming: | 1445 |
| LEAP-Seq n nonconfirming: | 143 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACCCCATACACATCTCC |
| Suggested primer 2: | TACCTGCTGCCTAACGGTTT |