Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.232286 |
Chromosome: | chromosome 10 |
Location: | 90679 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g418250 | BLD10 | Basal body protein; (1 of 4) PTHR13140:SF289 - UNCONVENTIONAL MYOSIN-XIX | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAAGGTGGGAGACGGGCTGCCGGGGGTG |
Internal bar code: | ACGTAATAACGCGACGCGGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 634 |
LEAP-Seq percent confirming: | 93.4615 |
LEAP-Seq n confirming: | 243 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGCAGAGGTAAGGTGTCC |
Suggested primer 2: | CACACCTGGCTGTCTAGCAA |