| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.232517 |
| Chromosome: | chromosome 12 |
| Location: | 2539692 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g505800 | MSC6,MSCL2,CAM16 | (1 of 2) IPR002048//IPR006685//IPR010920 - EF-hand domain // Mechanosensitive ion channel MscS // LSM domain; Predicted protein with mechanosensitive ion channel domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATGACGCAGGTACATTGTGGCCCGCGA |
| Internal bar code: | GCCACGTAATGGACACTAACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 213 |
| LEAP-Seq percent confirming: | 76.2887 |
| LEAP-Seq n confirming: | 296 |
| LEAP-Seq n nonconfirming: | 92 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACAACACACACGCAT |
| Suggested primer 2: | GGTGAGGCTTGTAGTGAGGC |