| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.232630 |
| Chromosome: | chromosome 5 |
| Location: | 3164375 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239500 | FAP38 | (1 of 1) IPR000104//IPR009068 - Antifreeze protein, type I // S15/NS1, RNA-binding; Flagellar Associated Protein 38 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGATTTGATGTTGCGCGGCAGTGGCGGT |
| Internal bar code: | TACGTTGGCGGATTGCGGTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 444 |
| LEAP-Seq percent confirming: | 99.2726 |
| LEAP-Seq n confirming: | 2320 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTAAGCGAGGCGATAAGG |
| Suggested primer 2: | CTACCCTCCCCTTGTCCTTC |