| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.232894 |
| Chromosome: | chromosome 13 |
| Location: | 2658736 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581700 | (1 of 6) 2.7.7.84 - 2'-5' oligoadenylate synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAAATGCACAGCAGTATGGACGAATCA |
| Internal bar code: | GGACAACTCTTTGACACCGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 614 |
| LEAP-Seq percent confirming: | 99.2119 |
| LEAP-Seq n confirming: | 1133 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTTGCCATTTGCATAGCG |
| Suggested primer 2: | ATGGGCAGCAAATACACCTC |