| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.232946 |
| Chromosome: | chromosome 7 |
| Location: | 3025823 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g333450 | SGT1 | Sterol 3-beta-glucosyltransferase; (1 of 2) 2.4.1.173 - Sterol 3-beta-glucosyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTCAACCCCAACCATGTCCCGCATTCCC |
| Internal bar code: | TCTGGTTGTGCCGTAATTGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1073 |
| LEAP-Seq percent confirming: | 99.7171 |
| LEAP-Seq n confirming: | 9871 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCATACCGAACACGAAC |
| Suggested primer 2: | GAAGGGAGTGGAGGGACTTC |