| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.232949 |
| Chromosome: | chromosome 9 |
| Location: | 1738292 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396650 | PAT2 | Phosphate acetyltransferase; (1 of 2) 2.3.1.8 - Phosphate acetyltransferase / Phosphotransacetylase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCGCAGGTGCGGGCGGGAGGGGGGGGAG |
| Internal bar code: | GCCCGCAGGCACAGATAACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 277 |
| LEAP-Seq percent confirming: | 1.91278 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 1282 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTCTTCCTCTCGGACAT |
| Suggested primer 2: | CCTCCGAAATAACCCTCTCC |