| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.232989 |
| Chromosome: | chromosome 13 |
| Location: | 1691907 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574250 | MLTK1,MLTK | (1 of 4) IPR000719//IPR001245//IPR002290//IPR006189//IPR011009//IPR020635 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // CHASE domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain; mitogen activated kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGATGACACTTCTCAGTGCCCGACGTCGA |
| Internal bar code: | GTCGGCTTCTCTGGCGGATGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 652 |
| LEAP-Seq percent confirming: | 97.8029 |
| LEAP-Seq n confirming: | 3116 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 84 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGAGCAAAGACCAAAAGG |
| Suggested primer 2: | GCAGTATAATGGACGGCGTT |