Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.233065 |
Chromosome: | chromosome 15 |
Location: | 1191144 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g641250 | CNE1 | (1 of 1) PTHR23056//PTHR23056:SF48 - CALCINEURIN B // SUBFAMILY NOT NAMED; Calcineurin-like phosphoesterase family protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAATTCTTGATGGTGCAGCCGACACACC |
Internal bar code: | GGACGGTGTGATACTAACCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 511 |
LEAP-Seq percent confirming: | 98.4162 |
LEAP-Seq n confirming: | 10688 |
LEAP-Seq n nonconfirming: | 172 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGTACCGTAGTCATTGCCA |
Suggested primer 2: | CACACACATCCCGAAAACAG |