| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.233072 |
| Chromosome: | chromosome 2 |
| Location: | 3031221 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095045 | (1 of 1) PF00628//PF13871//PF13872 - PHD-finger (PHD) // C-terminal domain on Strawberry notch homologue (Helicase_C_4) // P-loop containing NTP hydrolase pore-1 (AAA_34) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGCTGCAGCAGATGGGGCAAGCGGGGG |
| Internal bar code: | ACCGGTTAGCCGAATGGAGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 257 |
| LEAP-Seq percent confirming: | 97.4763 |
| LEAP-Seq n confirming: | 618 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCGCCATGTTAACCATCT |
| Suggested primer 2: | GAGGAGGAGGTTTCGGAGTC |