Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.233073 |
Chromosome: | chromosome 12 |
Location: | 4051956 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g517451 | (1 of 1) PTHR31773:SF9 - METACASPASE-1 | CDS/5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTATGGTTATCCCCCGCCCGCTTACGGC |
Internal bar code: | TTACGATTTGGTTTTAATATCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 878 |
LEAP-Seq percent confirming: | 99.5018 |
LEAP-Seq n confirming: | 12384 |
LEAP-Seq n nonconfirming: | 62 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAAACCAACTGCAAGCCCTC |
Suggested primer 2: | ACCTGTCACTCGCCTTCTGT |