Insertion junction: LMJ.RY0402.233122_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.233122
Chromosome:chromosome_8
Location:4151437
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GCCGTACGCTCGTCACCGTACGACAGAGAT
Internal bar code:CCCGGCATTCGGTGCGGCCGTT

Confirmation - LEAP-Seq

LEAP-Seq distance:615
LEAP-Seq percent confirming:94.576
LEAP-Seq n confirming:1238
LEAP-Seq n nonconfirming:71
LEAP-Seq n unique pos:29

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCCTGTGCTTTCCTGCT
Suggested primer 2:TTGTAACGACAGCTTGCGAC