Insertion junction: LMJ.RY0402.233122_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.233122
Chromosome:chromosome_8
Location:4151441
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CGCCGCTGCTTGGCGGCGGCGGGACAGGCG
Internal bar code:CTTTCTTGGTGATCAGGTCCC

Confirmation - LEAP-Seq

LEAP-Seq distance:447
LEAP-Seq percent confirming:98.9384
LEAP-Seq n confirming:466
LEAP-Seq n nonconfirming:5
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCCTGTGCTTTCCTGCT
Suggested primer 2:TTGTAACGACAGCTTGCGAC